![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3925 |
|||||
Accession | MI0016433 (change log) | ||||
Symbol | HGNC:MIR3925 | ||||
Description | Homo sapiens miR-3925 stem-loop | ||||
Stem-loop |
g c uca 5' gugggaauagcaagagaacugaaa uggag cug c |||||||||||||||||||||||| ||||| ||| a 3' caccuuuaucguucucuugauuuu accuc gac u g a cuc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-3925-5p |
|
Accession | MIMAT0018200 |
Previous IDs | hsa-miR-3925 |
Sequence |
12 - aagagaacugaaaguggagccu - 33 |
Deep sequencing | 20 reads, 13 experiments |
Evidence | experimental; Illumina [1-2] |
Predicted targets |
|
Mature sequence hsa-miR-3925-3p |
|
Accession | MIMAT0019228 |
Sequence |
47 - acuccaguuuuaguucucuug - 67 |
Deep sequencing | 4 reads, 4 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|