![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3926-2 |
||||||||
Accession | MI0016437 (change log) | |||||||
Symbol | HGNC:MIR3926-2 | |||||||
Description | Homo sapiens miR-3926-2 stem-loop | |||||||
Gene family | MIPF0001118; mir-3926 | |||||||
Stem-loop |
gcu
5' ggagcuggccaaaaagcaggcagagac u
||||||||||||||||||||||||||| u
3' ccucgaccgguuuuucguccgucucug u
aaa
|
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence hsa-miR-3926 |
|
Accession | MIMAT0018201 |
Sequence |
6 - uggccaaaaagcaggcagaga - 26 |
Deep sequencing | 217 reads, 48 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|