Stem-loop sequence smr-mir-282

AccessionMI0016440 (change log)
DescriptionStrigamia maritima miR-282 stem-loop
Gene family MIPF0000150; mir-282
Literature search

1 open access papers mention smr-mir-282
(1 sentences)

Stem-loop
   -gaa      u     uaa   u   c a           uuug 
5'     ccggca uguau   gcc cuc c ggcuuagucug    u
       |||||| |||||   ||| ||| | |||||||||||    u
3'     gguugu acaua   cgg gag g cugagucaggu    u
   uuua      u     caa   u   a c           uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence smr-miR-282

Accession MIMAT0018915
Sequence

17 - 

aagccucucccaggcuuagucu

 - 38

Get sequence
Evidence not experimental

References

1
PMID:20702459 "A congruent solution to arthropod phylogeny: phylogenomics, microRNAs and morphology support monophyletic Mandibulata" Rota-Stabelli O, Campbell L, Brinkmann H, Edgecombe GD, Longhorn SJ, Peterson KJ, Pisani D, Philippe H, Telford MJ Proc Biol Sci. 278:298-306(2011).