Stem-loop sequence smr-mir-965

AccessionMI0016441 (change log)
DescriptionStrigamia maritima miR-965 stem-loop
Gene family MIPF0000708; mir-965
Literature search

1 open access papers mention smr-mir-965
(1 sentences)

Stem-loop
   aac    --   ug     a              ag   -   au   u  gu 
5'    uggu  ggu  ccuag gggagaagcuguac  gcu aug  ucg ac  a
      ||||  |||  ||||| ||||||||||||||  ||| |||  ||| ||  u
3'    acca  uca  ggauc cccuuuucgguaug  cga uac  agc ug  c
   uca    aa   ga     -              --   a   --   -  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence smr-miR-965

Accession MIMAT0018916
Sequence

63 - 

uaagcguauggcuuuuccccu

 - 83

Get sequence
Evidence not experimental

References

1
PMID:20702459 "A congruent solution to arthropod phylogeny: phylogenomics, microRNAs and morphology support monophyletic Mandibulata" Rota-Stabelli O, Campbell L, Brinkmann H, Edgecombe GD, Longhorn SJ, Peterson KJ, Pisani D, Philippe H, Telford MJ Proc Biol Sci. 278:298-306(2011).