Stem-loop sequence smr-mir-3930

AccessionMI0016442 (change log)
DescriptionStrigamia maritima miR-3930 stem-loop
Literature search

1 open access papers mention smr-mir-3930
(1 sentences)

Stem-loop
   uaa       u  uuca  gu              g  ---g  a 
5'    ucgccuu gc    cg  ucuguuacggugua ag    ga u
      ||||||| ||    ||  |||||||||||||| ||    || u
3'    agcggga cg    gc  agacgaugccgcau uc    cu a
   aug       c  cauc  ug              g  aaaa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence smr-miR-3930-5p

Accession MIMAT0018917
Previous IDssmr-miR-3930
Sequence

17 - 

acgguucuguuacgguguaga

 - 37

Get sequence
Evidence not experimental

Mature sequence smr-miR-3930-3p

Accession MIMAT0018918
Previous IDssmr-miR-3930*
Sequence

55 - 

guacgccguagcagagucgcu

 - 75

Get sequence
Evidence not experimental

References

1
PMID:20702459 "A congruent solution to arthropod phylogeny: phylogenomics, microRNAs and morphology support monophyletic Mandibulata" Rota-Stabelli O, Campbell L, Brinkmann H, Edgecombe GD, Longhorn SJ, Peterson KJ, Pisani D, Philippe H, Telford MJ Proc Biol Sci. 278:298-306(2011).