Stem-loop sequence hvu-MIR159b

AccessionMI0016451 (change log)
DescriptionHordeum vulgare miR159b stem-loop
Gene family MIPF0000010; MIR159
Literature search

15 open access papers mention hvu-MIR159b
(88 sentences)

Stem-loop
   cuga   c  u       g     a    ug  ucu   ucuauuacuaauuaguuuccucuu 
5'     ccg ug uuggauu aaggg gcuc  ca   uga                        c
       ||| || ||||||| ||||| ||||  ||   |||                         
3'     ggu ac gaucuag uucuc cggg  gu   acu                        c
   ----   -  c       a     c    gu  -uu   aaagguccgaacguacgucgucuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR159b

Accession MIMAT0018209
Sequence

11 - 

uuuggauugaagggagcucug

 - 31

Get sequence
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).