Stem-loop sequence tae-MIR319

AccessionMI0016453 (change log)
DescriptionTriticum aestivum miR319 stem-loop
Gene family MIPF0000010; MIR159
Literature search

13 open access papers mention tae-MIR319
(40 sentences)

Stem-loop
   -aguu           a          cu     g   u  cg    uu      g  g   a  -     a    ag a       g    gagacuaguccaggg 
5'      ugagggagcuc cuucagucca  caugg agg ag  ggga  gaacga cu ccg cu cauuc cucg  c cacagua auau               c
        ||||||||||| ||||||||||  ||||| ||| ||  ||||  |||||| || ||| || ||||| ||||  | ||||||| ||||                
3'      acucccucgag gaagucaggu  guacc ucc uc  uucu  cuuguu ga ggc ga guaag gagu  g gugucau uaua               a
   ucucu           g          uc     -   -  cu    cu      a  g   -  c     c    aa c       g    acauuguaugaccau 
Get sequence
Deep sequencing
148317710 reads, 7.12e+05 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
4D: 46944255-46944465 [-]
intergenic
Database links

Mature sequence tae-miR319

Accession MIMAT0018211
Sequence

184 - 

uuggacugaagggagcucccu

 - 204

Get sequence
Deep sequencing148317607 reads, 116 experiments
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).