Stem-loop sequence hvu-MIR166a

AccessionMI0016455 (change log)
Previous IDshvu-MIR166
DescriptionHordeum vulgare miR166 stem-loop
Gene family MIPF0000004; MIR166
Literature search

8 open access papers mention hvu-MIR166a
(43 sentences)

Stem-loop
   c    uu    a         cn  g     naaaga     ncuc    g   u 
5'  augg  gucg ggggaauga  cc ggucc      gagac    gcau gcg g
    ||||  |||| |||||||||  || |||||      |||||    |||| |||  
3'  uacc  cagu ccccuuacu  gg ccagg      cuuug    cgug ugc c
   -    -u    a         uc  a     ------     ----    g   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR166a

Accession MIMAT0018213
Previous IDshvu-miR166
Sequence

70 - 

ucggaccaggcuucauucccc

 - 90

Get sequence
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).
2
PMID:23324356 "Developmentally regulated expression and complex processing of barley pri-microRNAs" Kruszka K, Pacak A, Swida-Barteczka A, Stefaniak AK, Kaja E, Sierocka I, Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z BMC Genomics. 14:34(2013).