Stem-loop sequence tae-MIR167b

AccessionMI0016456 (change log)
DescriptionTriticum aestivum miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

27 open access papers mention tae-MIR167b
(118 sentences)

Stem-loop
   cu   caa     c      a    --a    ---------a     uauc 
5'   gcc   gggaa gaguga gcug   cagc          ugauc    u
     |||   ||||| |||||| ||||   ||||          |||||    c
3'   cgg   cccuu uucacu cgac   gucg          acuag    c
   -g   ---     c      c    ggc    caaagaacaa     ugag 
Get sequence
Deep sequencing
1115765 reads, 5.56e+03 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR167b

Accession MIMAT0018214
Sequence

18 - 

ugaagcugacagcaugaucua

 - 38

Get sequence
Deep sequencing1115744 reads, 116 experiments
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).