Stem-loop sequence hvu-MIR168

AccessionMI0016457 (change log)
DescriptionHordeum vulgare miR168 stem-loop
Gene family MIPF0000081; MIR168
Literature search

13 open access papers mention hvu-MIR168
(52 sentences)

Stem-loop
   guc   c  c    c   g gc             au     ccc    -    cc 
5'    cgu gc gccg cuc g  ucgcuuggugcag  cggga   uccg cccg  c
      ||| || |||| ||| |  |||||||||||||  |||||   |||| ||||   
3'    gcg cg cggc gag c  agugaaccacguu  gcccu   aggc gggc  c
   ---   a  -    c   g ua             cc     ---    c    ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR168-5p

Accession MIMAT0018215
Sequence

23 - 

ucgcuuggugcagaucgggac

 - 43

Get sequence
Evidence not experimental

Mature sequence hvu-miR168-3p

Accession MIMAT0018216
Sequence

67 - 

gaucccgccuugcaccaagugaau

 - 90

Get sequence
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).
2
PMID:20676715 "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" Kantar M, Unver T, Budak H Funct Integr Genomics. 10:493-507(2010).
3
PMID:23324356 "Developmentally regulated expression and complex processing of barley pri-microRNAs" Kruszka K, Pacak A, Swida-Barteczka A, Stefaniak AK, Kaja E, Sierocka I, Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z BMC Genomics. 14:34(2013).