Stem-loop sequence tae-MIR169

AccessionMI0016460 (change log)
DescriptionTriticum aestivum miR169 stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

23 open access papers mention tae-MIR169
(92 sentences)

Stem-loop
   -     ----        ccau     -a     a   a             a    c  uu   a   ga          
5'  ugggg    guaagagg    cuucg  uagcc agg ugauuugccugug aacu cc  ggc gcc  gcucucugc 
    |||||    ||||||||    |||||  ||||| ||| ||||||||||||| |||| ||  ||| |||  |||||||| c
3'  acccc    cauucucc    gaagc  aucgg ucc acugaacggguac uugg gg  cug cgg  cgagagaca 
   u     acac        --au     cc     g   c             c    c  -c   -   --          
Get sequence
Deep sequencing
12392 reads, 9.48 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR169

Accession MIMAT0018219
Sequence

103 - 

gggcaagucacccugggcuacc

 - 124

Get sequence
Deep sequencing59 reads, 58 experiments
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).