Stem-loop sequence hvu-MIR397a

AccessionMI0016465 (change log)
Previous IDshvu-MIR397
DescriptionHordeum vulgare miR397 stem-loop
Gene family MIPF0000120; MIR397
Literature search

4 open access papers mention hvu-MIR397a
(8 sentences)

Stem-loop
   ----c         c     a           a       -       a   cccguc 
5'      gcagaggug cguug gugcagcguug ugaaccg uccggcc ugg      c
        ||||||||| ||||| ||||||||||| ||||||| ||||||| |||       
3'      cgucuccgc guaac cacgucgcggc acuuggc aggccgg gcc      g
   ucuuu         a     g           c       g       a   accucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvu-miR397a

Accession MIMAT0018224
Previous IDshvu-miR397
Sequence

11 - 

ccguugagugcagcguugaug

 - 31

Get sequence
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).