Stem-loop sequence tae-MIR444b

AccessionMI0016467 (change log)
DescriptionTriticum aestivum miR444b stem-loop
Gene family MIPF0000402; MIR444
Literature search

13 open access papers mention tae-MIR444b
(33 sentences)

Stem-loop
   ga           c    c     a       a         u             g        -  -a a   -----   u 
5'   uaugcaugugg ggca cgagc ugaggca caacugcau acuugcggggaag cgcaagua gg  c ccu     gca u
     ||||||||||| |||| ||||| ||||||| ||||||||| ||||||||||||| |||||||| ||  | |||     ||| a
3'   auauguacacc ccgu guucg acuccgu guugacgug ugaacguucuuuc guguucau cc  g gga     cgu c
   --           u    c     a       c         c             g        a  ac c   acaaa   u 
Get sequence
Deep sequencing
25238 reads, 74.1 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR444b

Accession MIMAT0018226
Sequence

129 - 

uugcugccucaagcuugcugc

 - 149

Get sequence
Deep sequencing21842 reads, 116 experiments
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).