Stem-loop sequence tae-MIR171b

AccessionMI0016468 (change log)
DescriptionTriticum aestivum miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

19 open access papers mention tae-MIR171b
(54 sentences)

Stem-loop
   ugaguuaauccugcgaggggagugaacgc        ug          ag  a cu  c     agg 
5'                              gguauugg  cgguucaauc  ag g  gg gcccc   a
                                ||||||||  ||||||||||  || |  || |||||   g
3'                              cuauaacc  gccgaguuag  uc c  cc ugggg   g
   uccuccuacgcuaaguacucuuuggcgca        gu          cu  - cu  u     aac 
Get sequence
Deep sequencing
37159 reads, 169 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
2D: 132845309-132845446 [-]
intergenic
Database links

Mature sequence tae-miR171b

Accession MIMAT0018227
Sequence

92 - 

uugagccgugccaauaucacg

 - 112

Get sequence
Deep sequencing36700 reads, 116 experiments
Evidence not experimental

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).