Stem-loop sequence gma-MIR4341

AccessionMI0016470 (change log)
DescriptionGlycine max miR4341 stem-loop
Literature search

1 open access papers mention gma-MIR4341
(1 sentences)

Stem-loop
       -      g                   c      gguguaaccacaccuuccc 
5' accc ucaugu aaacuuucaacauauuucu uauuua                   u
   |||| |||||| ||||||||||||||||||| ||||||                   c
3' uggg aguaca uuugaaaguuguguagaga auagau                   a
       c      a                   a      auauucuuagauaacucac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 12004246-12004361 [-]
intergenic
Database links

Mature sequence gma-miR4341

Accession MIMAT0018229
Sequence

91 - 

uguguugaaaguuuaacaugacgg

 - 114

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).