Stem-loop sequence gma-MIR4345

AccessionMI0016474 (change log)
DescriptionGlycine max miR4345 stem-loop
Literature search

1 open access papers mention gma-MIR4345
(1 sentences)

Stem-loop
   g    c              c              -          a 
5'  gaag uaagacggaacuua aaagauuguucagg uagacauuug g
    |||| |||||||||||||| |||||||||||||| ||||||||||  
3'  uuuc auucugcuuugaau uuucuaacaaguuc gucuguaaau a
   -    a              u              u          a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 48700139-48700232 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR4345
gma-MIR9734chr14: 48700793-48700984 [-]
gma-MIR4345chr14: 48700139-48700232 [-]
Database links

Mature sequence gma-miR4345

Accession MIMAT0018233
Sequence

7 - 

uaagacggaacuuacaaagauu

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).