Stem-loop sequence gma-MIR1520e

AccessionMI0016484 (change log)
DescriptionGlycine max miR1520e stem-loop
Gene family MIPF0000581; MIR1520
Literature search

2 open access papers mention gma-MIR1520e
(2 sentences)

Stem-loop
   ua       cg a         g                   a      a    a     ucaaugaaaacagcaaugcau 
5'   acuguca  u ucacguucu auuggaugaugacugucac ugucau uucu auugg                     u
     |||||||  | ||||||||| ||||||||||||||||||| |||||| |||| |||||                      
3'   ugacagu  a agugcaaga uaaccuacugcugacagug acagua aaga uaacc                     u
   ac       au c         a                   c      c    c     uacaguugagguacuuucuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 17845222-17845385 [-]
intergenic
Database links

Mature sequence gma-miR1520e

Accession MIMAT0018243
Sequence

138 - 

caauaagaacgugacauaugacag

 - 161

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).