Stem-loop sequence gma-MIR1520f

AccessionMI0016485 (change log)
DescriptionGlycine max miR1520f stem-loop
Gene family MIPF0000581; MIR1520
Literature search

2 open access papers mention gma-MIR1520f
(2 sentences)

Stem-loop
   uucuuacuaaaugac        c                acaugaaa       ugca 
5'                gauuguca gugucauguucugauu        gaugaaa    u
                  |||||||| ||||||||||||||||        |||||||    u
3'                cuaacagu cacaguacaagacuaa        uuacuuu    g
   --------------a        a                ----ccag       uauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 17814168-17814270 [-]
intergenic
Database links

Mature sequence gma-miR1520f-5p

Accession MIMAT0032111
Sequence

17 - 

auugucacgugucauguucugauu

 - 40

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gma-miR1520f-3p

Accession MIMAT0018244
Previous IDsgma-miR1520f
Sequence

77 - 

caaucagaacaugacacaugacaa

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2