Stem-loop sequence gma-MIR1520g

AccessionMI0016486 (change log)
DescriptionGlycine max miR1520g stem-loop
Gene family MIPF0000581; MIR1520
Literature search

2 open access papers mention gma-MIR1520g
(2 sentences)

Stem-loop
          c                  a     a  uugaauccauggaagaua 
5' augauga ugucacgugucauguucu auuga uc                  a
   ||||||| |||||||||||||||||| ||||| ||                  a
3' uacuacu acagugcacaguacaaga uaacu ag                  a
          a                  c     -  uuacuauuguuauuacau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr12: 32708631-32708738 [-]
intergenic
Database links

Mature sequence gma-miR1520g

Accession MIMAT0018245
Sequence

78 - 

caaucagaacaugacacgugacaa

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).