Stem-loop sequence gma-MIR1520h

AccessionMI0016496 (change log)
DescriptionGlycine max miR1520h stem-loop
Gene family MIPF0000581; MIR1520
Literature search

2 open access papers mention gma-MIR1520h
(2 sentences)

Stem-loop
                  a    a        -ucu    -  u  g 
5' cacgugucacguucu auug acguugau    auag ac au a
   ||||||||||||||| |||| ||||||||    |||| || ||  
3' guguacagugcaaga uaac ugcaacug    uguu ug ua a
                  c    c        uugu    a  -  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 15546820-15546906 [+]
intergenic
Database links

Mature sequence gma-miR1520h

Accession MIMAT0018255
Sequence

62 - 

aacguccaaucagaacgugacaug

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).