Stem-loop sequence gma-MIR4361

AccessionMI0016497 (change log)
DescriptionGlycine max miR4361 stem-loop
Gene family MIPF0001296; MIR4347
Literature search

2 open access papers mention gma-MIR4361
(2 sentences)

Stem-loop
   c           g         a      a 
5'  aaguugauccg aagucucuu cggauc a
    ||||||||||| ||||||||| |||||| g
3'  uucaacuaggc uucagagaa gccuag u
   a           a         g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 15914012-15914074 [+]
intergenic
chr17: 24120956-24121018 [-]
intergenic
Database links

Mature sequence gma-miR4361

Accession MIMAT0018256
Sequence

38 - 

ccggaagagacuuacggaucaacu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).