Stem-loop sequence gma-MIR1520i

AccessionMI0016498 (change log)
DescriptionGlycine max miR1520i stem-loop
Gene family MIPF0000581; MIR1520
Literature search

2 open access papers mention gma-MIR1520i
(2 sentences)

Stem-loop
   ua        ua              cuuauuggauuaugacugucacgugucauguucugauuggucaau 
5'   auguugac  ucacgugucacguu                                             g
     ||||||||  ||||||||||||||                                              
3'   uacaacug  agugcacagugcaa                                             a
   ac        gc              aacuaacuuacaguugagguauuuucuaauuuacauaacaauaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 34949369-34949512 [-]
intergenic
Database links

Mature sequence gma-miR1520i

Accession MIMAT0018257
Sequence

119 - 

aacgugacacgugacggucaacau

 - 142

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).