Stem-loop sequence gma-MIR4380a

AccessionMI0016502 (change log)
DescriptionGlycine max miR4380a stem-loop
Gene family MIPF0001117; MIR4380
Literature search

1 open access papers mention gma-MIR4380a
(1 sentences)

Stem-loop
                a               a gu    c                  agcaauccguaugggucaua 
5' guaugcacauacg auuagcaaucuguau g  caug ggauugucaaucuguaug                    c
   ||||||||||||| ||||||||||||||| |  |||| ||||||||||||||||||                     
3' cauacguguaugc uaguuguuaggcaug c  guau ccuaacgguuaggcauac                    g
                c               - ug    a                  cuaguaugucuagucguuag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 39453514-39453666 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR4380a
gma-MIR4380achr1: 39453514-39453666 [-]
gma-MIR5673chr1: 39450461-39450567 [+]
Database links

Mature sequence gma-miR4380a

Accession MIMAT0018261
Sequence

128 - 

cggauuguugauccguaugugcau

 - 151

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).