Stem-loop sequence gma-MIR1520j

AccessionMI0016504 (change log)
DescriptionGlycine max miR1520j stem-loop
Gene family MIPF0000581; MIR1520
Literature search

4 open access papers mention gma-MIR1520j
(6 sentences)

Stem-loop
            c     ca                a        u       acc             auaucaacuccaugaaagaug 
5' gaauguuga uguca  ugucacguucuuauug augaugau gucacgu   auguuaugauugg                     a
   ||||||||| |||||  |||||||||||||||| |||||||| |||||||   |||||||||||||                      
3' cuuacaacu acagu  acagugcaagaauaac uacuacug uagugca   uacaauacuaacc                     a
            a     ac                c        c       caa             aaucacuuuuauuauuacgua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 5133814-5133989 [-]
intergenic
Database links

Mature sequence gma-miR1520j

Accession MIMAT0018263
Sequence

148 - 

aagaacgugacacaugacaaucaa

 - 171

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).