Stem-loop sequence gma-MIR4365

AccessionMI0016505 (change log)
DescriptionGlycine max miR4365 stem-loop
Literature search

1 open access papers mention gma-MIR4365
(1 sentences)

Stem-loop
   aagaacu             c                    a      ua 
5'        ucuuccgcgagau gcauggaagaagguucuucc caguug  a
          ||||||||||||| |||||||||||||||||||| ||||||   
3'        agaaggugcucua cguaccuucuuccaagaagg gucaau  c
   ------a             c                    c      ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 11249866-11249961 [-]
intergenic
Database links

Mature sequence gma-miR4365

Accession MIMAT0018264
Sequence

1 - 

aagaacuucuuccgcgagaucgca

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).