Stem-loop sequence gma-MIR4366

AccessionMI0016506 (change log)
DescriptionGlycine max miR4366 stem-loop
Literature search

1 open access papers mention gma-MIR4366
(1 sentences)

Stem-loop
                                 c      g    a        c                                                       u        --gu  cc      a 
5' aagagaugugaaaacaccuuagaaguugag uagaua aaaa gaaaggcu uugaaacaagauccaaauuccucaaagcaugcaaaccaaccaacaaaucucuacu aguaggga    cc  uuucaa a
   |||||||||||||||||||||||||||||| |||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    ||  ||||||  
3' uucucuacacuuuuguggaaucuucaacuc aucuau uuuu cuuuccga aacuuuguucuagguuuaagggguuucguacguuugguugguuguuuagagauga ucaucccu    gg  gagguu a
                                 a      a    c        c                                                       u        aaau  aa      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 29557157-29557418 [-]
intergenic
Database links

Mature sequence gma-miR4366

Accession MIMAT0018265
Sequence

150 - 

cuacuuaguagagauuuguugg

 - 171

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2