Stem-loop sequence gma-MIR4369

AccessionMI0016511 (change log)
DescriptionGlycine max miR4369 stem-loop
Gene family MIPF0001150; MIR4343
Literature search

2 open access papers mention gma-MIR4369
(4 sentences)

Stem-loop
   u     u           a         ---gaa  ga u 
5'  uuucc cuuucggauca cuugauccg      ga  c u
    ||||| ||||||||||| |||||||||      ||  |  
3'  aaagg gaaggccuagu gaacuaggc      cu  g a
   a     u           c         auucaa  ag c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 13628703-13628781 [-]
intergenic
Database links

Mature sequence gma-miR4369

Accession MIMAT0018270
Sequence

53 - 

ggaucaagcugauccggaagugga

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).