Stem-loop sequence gma-MIR4387b

AccessionMI0016513 (change log)
DescriptionGlycine max miR4387b stem-loop
Literature search

1 open access papers mention gma-MIR4387b
(1 sentences)

Stem-loop
                              gu   gccacaucauucaagguguuggu 
5' gugacaggcagagugucaugucaucau  cuu                       g
   |||||||||||||||||||||||||||  |||                        
3' cacugucugucucacaguacgguagug  gaa                       u
                              ug   uaguacuuguaguaaaguaacgg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 4991373-4991484 [+]
intergenic
Database links

Mature sequence gma-miR4387b

Accession MIMAT0018272
Sequence

81 - 

aaggugugauggcaugacacucug

 - 104

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).