Stem-loop sequence gma-MIR4374b

AccessionMI0016523 (change log)
DescriptionGlycine max miR4374b stem-loop
Gene family MIPF0001152; MIR4374
Literature search

2 open access papers mention gma-MIR4374b
(2 sentences)

Stem-loop
                           a             u      u    ga 
5' ggugcuuaccucagcaacgucuuu aaaguaggcauuc aagacg ugcu  a
   |||||||||||||||||||||||| ||||||||||||| |||||| ||||   
3' ccacgaauggaguuguugcagaaa uuucauccguaag uucugc acga  g
                           c             u      c    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 44789134-44789239 [+]
intergenic
Database links

Mature sequence gma-miR4374b

Accession MIMAT0018282
Sequence

76 - 

uacuuucaaagacguuguugag

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).