Stem-loop sequence gma-MIR4378a

AccessionMI0016524 (change log)
DescriptionGlycine max miR4378a stem-loop
Gene family MIPF0001192; MIR4378
Literature search

1 open access papers mention gma-MIR4378a
(1 sentences)

Stem-loop
       -a           g    g            a         aacacaaacucgucuuagaaugucauacauuuuaag 
5' ucau  ggacugucuua aaug uguacauucuaa acagucucc                                    a
   ||||  ||||||||||| |||| |||||||||||| |||||||||                                     
3' agug  ucuggcagaau uuac acauguaagauu uguuagggg                                    c
       cg           a    a            c         uccuauuuagguagaaucucacauacuguauucggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 44388201-44388363 [-]
intergenic
Database links

Mature sequence gma-miR4378a

Accession MIMAT0018283
Sequence

3 - 

auaggacugucuuagaauggugua

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).