Stem-loop sequence gma-MIR4380b

AccessionMI0016528 (change log)
DescriptionGlycine max miR4380b stem-loop
Gene family MIPF0001117; MIR4380
Literature search

1 open access papers mention gma-MIR4380b
(1 sentences)

Stem-loop
                            a          u 
5' gcguacggaucaacaauccguauga ccauauggau g
   ||||||||||||||||||||||||| |||||||||| g
3' ugcaugccuaguuguuaggcauacu gguaugccua c
                            -          a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 4425779-4425854 [+]
intergenic
Database links

Mature sequence gma-miR4380b

Accession MIMAT0018287
Sequence

47 - 

uauggucauacggauuguugau

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).