Stem-loop sequence gma-MIR4382

AccessionMI0016530 (change log)
DescriptionGlycine max miR4382 stem-loop
Literature search

1 open access papers mention gma-MIR4382
(1 sentences)

Stem-loop
          aa                             c      a    a                 c    -------------    a 
5' guacaua  uucagauccaugaaaucaguuaacauaug ccuuac gaca uauuccuacuuccccau uggc             ucug u
   |||||||  ||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||| ||||             ||||  
3' cauguau  aagucuagguacuuuagucaauuguauau ggaaug cugu auaaggaugaaggggua acug             agac a
          ca                             a      c    g                 u    aaauucaaacuag    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 18881198-18881368 [+]
intergenic
Database links

Mature sequence gma-miR4382

Accession MIMAT0018289
Sequence

136 - 

uauguuaacugauuucauggau

 - 157

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).