Stem-loop sequence gma-MIR1520k

AccessionMI0016532 (change log)
DescriptionGlycine max miR1520k stem-loop
Gene family MIPF0000581; MIR1520
Literature search

2 open access papers mention gma-MIR1520k
(2 sentences)

Stem-loop
   u         a            c                agucaaugaaaacagcaauguau 
5'  ucuuauugg ugaugauuguca gugucauguucugauu                       u
    ||||||||| |||||||||||| ||||||||||||||||                        
3'  agaauaacc acuacugacagu cacaguacaagacuaa                       u
   a         a            a                ccuacaguugugguacuuucuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 5256979-5257106 [+]
intergenic
Database links

Mature sequence gma-miR1520k

Accession MIMAT0018291
Sequence

89 - 

aaucagaacaugacacaugacagu

 - 112

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).