Stem-loop sequence gma-MIR1520l

AccessionMI0016533 (change log)
DescriptionGlycine max miR1520l stem-loop
Gene family MIPF0000581; MIR1520
Literature search

2 open access papers mention gma-MIR1520l
(2 sentences)

Stem-loop
                         a         ---      gaaaacaaca   c 
5' gaugaugauugucacgugucau uucugauug   gucaau          aug a
   |||||||||||||||||||||| |||||||||   ||||||          ||| u
3' uuacuacugauagugcacagua aagacuaac   caguug          uac u
                         c         uua      agguauauuc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 51411526-51411635 [+]
intergenic
Database links

Mature sequence gma-miR1520l

Accession MIMAT0018292
Sequence

80 - 

aaucagaacaugacacgugauagu

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).