Stem-loop sequence gma-MIR1520m

AccessionMI0016534 (change log)
DescriptionGlycine max miR1520m stem-loop
Gene family MIPF0000581; MIR1520
Literature search

2 open access papers mention gma-MIR1520m
(2 sentences)

Stem-loop
   u                c         c           uggaugucaacuccauaaaagaug 
5'  ucuuauuggaugauga uguuacgug cauguucugau                        a
    |||||||||||||||| ||||||||| |||||||||||                         
3'  agaauaacuuacuauu acaguguac guacaagacua                        a
   a                a         a           acuauuuacuuuuguuguuaagua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 9565785-9565912 [-]
intergenic
Database links

Mature sequence gma-miR1520m

Accession MIMAT0018293
Sequence

89 - 

aaucagaacaugacaugugacaau

 - 112

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).