Stem-loop sequence gma-MIR1520n

AccessionMI0016536 (change log)
DescriptionGlycine max miR1520n stem-loop
Gene family MIPF0000581; MIR1520
Literature search

3 open access papers mention gma-MIR1520n
(4 sentences)

Stem-loop
             a               ---   uc   uc  uuaaaaa 
5' auugucaugu uuauguuuugauuga   aug  aau  ca       u
   |||||||||| |||||||||||||||   |||  |||  ||       a
3' ugacagugca aguacaagacuaacu   uac  uua  gu       a
             c               aau   uu   uu  uauguaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 47470517-47470612 [+]
intergenic
Database links

Mature sequence gma-miR1520n

Accession MIMAT0018295
Sequence

71 - 

ucaaucagaacaugacacgugaca

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).