Stem-loop sequence gma-MIR1520o

AccessionMI0016537 (change log)
DescriptionGlycine max miR1520o stem-loop
Gene family MIPF0000581; MIR1520
Literature search

2 open access papers mention gma-MIR1520o
(2 sentences)

Stem-loop
   u           a                                  a  u           g         u  ua     ucuaug       aa 
5'  uacaaaagaau uugauugucaugugucacauucugauuggaugau ac gucauguguua guuuugauu aa  uugac      gacgaug  a
    ||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||| ||  |||||      |||||||   
3'  auguuuucuua aacugacaguguacaguguaagacuaaccugcua ug uaguguacagu caagauuaa uu  aacug      uuguuau  a
   a           c                                  c  u           g         c  gc     ---uug       gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 13437941-13438133 [+]
intergenic
Database links

Mature sequence gma-miR1520o

Accession MIMAT0018296
Sequence

145 - 

ucaucguccaaucagaaugugaca

 - 168

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).