Stem-loop sequence gma-MIR4387a

AccessionMI0016540 (change log)
DescriptionGlycine max miR4387a stem-loop
Gene family MIPF0001109; MIR4387
Literature search

2 open access papers mention gma-MIR4387a
(2 sentences)

Stem-loop
                       ac     c  g     c         c c    ac 
5' acgaagugucaugucaucac  cuugu ac gacac ucauuguca g cauc  c
   ||||||||||||||||||||  ||||| || ||||| ||||||||| | ||||   
3' ugcuucacagugcaguagug  gaaca ug uugug aguaacggu c guag  u
                       ca     a  a     c         a a    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
KQ474119.1: 490978-491089 [+]
intergenic
Database links

Mature sequence gma-miR4387a

Accession MIMAT0018299
Sequence

85 - 

aacaagacgugaugacgugacacu

 - 108

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).