Stem-loop sequence gma-MIR4388

AccessionMI0016541 (change log)
DescriptionGlycine max miR4388 stem-loop
Literature search

1 open access papers mention gma-MIR4388
(2 sentences)

Stem-loop
   ga a                                             cgacuuuacauuccguuugucacgguguua 
5'   c cugucaauuuggucuuuaagauuuaaaaaaugucaaaaugauccu                              g
     | |||||||||||||||||||||||||||||||||||||||||||||                               
3'   g gacaguuaaaccagggauucuaaauuuuuuauaguuuuacuagga                              g
   cc c                                             accgugcaaucagggacggcaaucaucaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 46504519-46504678 [-]
intergenic
Database links

Mature sequence gma-miR4388

Accession MIMAT0018300
Sequence

134 - 

aaucuuagggaccaaauugacagc

 - 157

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).