Stem-loop sequence gma-MIR4389

AccessionMI0016543 (change log)
DescriptionGlycine max miR4389 stem-loop
Literature search

1 open access papers mention gma-MIR4389
(1 sentences)

Stem-loop
         -         a      c     cuaguggccuaaccagaucgguuuuacuauuggauugaucaugc 
5' cggucg gucggaccg uccaau ggaau                                            a
   |||||| ||||||||| |||||| |||||                                             
3' gccggc cagccuggc agguug ccuua                                            a
         u         c      a     agcuauguauuagccggcucaaacuaguccaguaaguuccaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 32881750-32881896 [-]
intergenic
Database links

Mature sequence gma-miR4389

Accession MIMAT0018302
Sequence

4 - 

ucggucggaccgauccaaucggaa

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).