Stem-loop sequence gma-MIR4396

AccessionMI0016552 (change log)
DescriptionGlycine max miR4396 stem-loop
Literature search

1 open access papers mention gma-MIR4396
(2 sentences)

Stem-loop
                        au    a 
5' aaauauguaguuucuaagacg  gcug c
   |||||||||||||||||||||  ||||  
3' uuuauacauuaaagauucugu  cgau g
                        cc    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 3429421-3429478 [-]
intergenic
Database links

Mature sequence gma-miR4396

Accession MIMAT0018311
Sequence

6 - 

uguaguuucuaagacgaugcugac

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).