Stem-loop sequence gma-MIR4397

AccessionMI0016553 (change log)
DescriptionGlycine max miR4397 stem-loop
Literature search

2 open access papers mention gma-MIR4397
(3 sentences)

Stem-loop
   u         g          g           u u        cau     uc   a   ggaagg         acaa 
5'  uuucuagug ucgccgcauc uugacgcugac g acguacuu   cuccu  aga uuc      augccauaa    g
    ||||||||| |||||||||| ||||||||||| | ||||||||   |||||  ||| |||      |||||||||     
3'  aaagaucau agcgguguag aacugugacug c ugcauggg   gaggg  uuu aag      uaugguauu    c
   a         a          a           c c        aau     uu   a   -----a         acac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 38550859-38551015 [-]
intergenic
Database links

Mature sequence gma-miR4397-5p

Accession MIMAT0020953
Sequence

18 - 

caucguugacgcugacuguacg

 - 39

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gma-miR4397-3p

Accession MIMAT0018312
Previous IDsgma-miR4397
Sequence

130 - 

ugucaaagauguggcgaauacu

 - 151

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).