Stem-loop sequence gma-MIR1520r

AccessionMI0016554 (change log)
DescriptionGlycine max miR1520r stem-loop
Gene family MIPF0000581; MIR1520
Literature search

3 open access papers mention gma-MIR1520r
(3 sentences)

Stem-loop
           u           cauc           -    a   ugcguccaagaau 
5' acauugac gucacguguca    cugguuggaca ugaa aga             c
   |||||||| |||||||||||    ||||||||||| |||| |||              
3' uguaacug caguguacagu    gacuagccugu acuu ucu             c
           c           acaa           u    a   uuuuacaauauua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 49004957-49005071 [-]
intergenic
Database links

Mature sequence gma-miR1520r

Accession MIMAT0018313
Sequence

16 - 

ugucacauccugguuggacaugaa

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).