Stem-loop sequence gma-MIR4399

AccessionMI0016556 (change log)
DescriptionGlycine max miR4399 stem-loop
Literature search

2 open access papers mention gma-MIR4399
(2 sentences)

Stem-loop
   caauu      g           uc   c        a         g    ag   gu  aauua       cacau 
5'      uauuau ugucguuaguc  uuu uguuaagu augacgugg agac  agu  ca     ucauuga     u
        |||||| |||||||||||  ||| |||||||| ||||||||| ||||  |||  ||     |||||||     a
3'      augaug acagcaaucag  aaa gcaauuca uacuguacc ucug  uca  gu     aguaacu     u
   -----      g           ga   a        c         g    cu   ug  ---gc       uccuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr3: 23233443-23233593 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR4399
gma-MIR4399chr3: 23233443-23233593 [+]
gma-MIR4387echr3: 23234500-23234621 [+]
Database links

Mature sequence gma-miR4399

Accession MIMAT0018315
Sequence

122 - 

uuaacgaaaaaggacuaacgac

 - 143

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).