Stem-loop sequence gma-MIR4401a

AccessionMI0016560 (change log)
Previous IDsgma-MIR4401
DescriptionGlycine max miR4401 stem-loop
Gene family MIPF0001147; MIR4368
Literature search

1 open access papers mention gma-MIR4401a
(1 sentences)

Stem-loop
         u                    a                      u   a u 
5' cgucuu gaaugccuacuuucaaagac uuguugagguaagcaccgucuu gaa g a
   |||||| |||||||||||||||||||| |||||||||||||||||||||| ||| |  
3' gcagaa cuuacggaugaaaguuucug aacaacuccauucgugguagaa cuu c c
         u                    c                      u   a g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 28771219-28771334 [+]
intergenic
Database links

Mature sequence gma-miR4401a

Accession MIMAT0018319
Previous IDsgma-miR4401
Sequence

85 - 

acaacgucuuugaaaguaggcauu

 - 108

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2