Stem-loop sequence gma-MIR4403

AccessionMI0016562 (change log)
DescriptionGlycine max miR4403 stem-loop
Literature search

1 open access papers mention gma-MIR4403
(5 sentences)

Stem-loop
        g        a       cg   acggacacgugaauaccugucaaa 
5' gacac gacaccga cacgaca  gac                        c
   ||||| |||||||| |||||||  |||                        a
3' cugug cuguggcu guguugu  cug                        c
        g        -       ag   cgggcacaggcccaacuuaaacua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 665909-666012 [+]
intergenic
Database links

Mature sequence gma-miR4403

Accession MIMAT0018321
Sequence

4 - 

acggacaccgaacacgacacggac

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).