Stem-loop sequence gma-MIR1520p

AccessionMI0016563 (change log)
DescriptionGlycine max miR1520p stem-loop
Gene family MIPF0000581; MIR1520
Literature search

3 open access papers mention gma-MIR1520p
(3 sentences)

Stem-loop
                               g  a    u    ag a      aau    acuuc        u 
5' acaugucauguuguuauuggaugaugac gu acau uuau  u ugauug   guca     augaaaga a
   |||||||||||||||||||||||||||| || |||| ||||  | ||||||   ||||     |||||||| a
3' uguacagugcaacaauaaccuacuacug ca ugua aaua  a acuaac   cagu     uacuuuuu u
                               a  g    c    ca a      ---    -----        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 4663268-4663406 [+]
intergenic
Database links

Mature sequence gma-miR1520p

Accession MIMAT0018322
Sequence

8 - 

auguuguuauuggaugaugacggu

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).