Stem-loop sequence gma-MIR4406

AccessionMI0016566 (change log)
DescriptionGlycine max miR4406 stem-loop
Literature search

1 open access papers mention gma-MIR4406
(1 sentences)

Stem-loop
   caa         a        ga              a    c            - - uuc 
5'    ucuauauug uucugaga  accgguguagaaug uaau auucuaagacgg c c   g
      ||||||||| ||||||||  |||||||||||||| |||| |||||||||||| | |    
3'    agauguagc aagacucu  uggcuacaucuuac auug uaagauuuugcc g g   a
   gua         c        gc              g    c            a u uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 40696309-40696432 [+]
intergenic
Database links

Mature sequence gma-miR4406

Accession MIMAT0018325
Sequence

9 - 

auugauucugagagaaccggugua

 - 32

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2