Stem-loop sequence gma-MIR4407

AccessionMI0016567 (change log)
DescriptionGlycine max miR4407 stem-loop
Literature search

2 open access papers mention gma-MIR4407
(3 sentences)

Stem-loop
         ucug          -            g   a   aau      ----u  cuuc      uu 
5' aaguug    gguugaggua aaguguugcuuc ucu agu   uaaugu     gc    auucaa  c
   ||||||    |||||||||| |||||||||||| ||| |||   ||||||     ||    ||||||   
3' uucaau    ucaacuccau uucacgacgaag aga uca   auuacg     cg    ugaguu  a
         -uaa          g            g   c   --c      ugcau  -cau      ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 47144592-47144722 [+]
intergenic
Database links

Mature sequence gma-miR4407

Accession MIMAT0018326
Sequence

95 - 

cagaggaagcagcacuuguacc

 - 116

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).