Stem-loop sequence gma-MIR4409

AccessionMI0016569 (change log)
DescriptionGlycine max miR4409 stem-loop
Literature search

1 open access papers mention gma-MIR4409
(1 sentences)

Stem-loop
   uccauuag       ag       g ug      
5'         aauaaca  uggguuu u  acuga 
           |||||||  ||||||| |  |||| a
3'         uuauugu  auccaaa a  ugaua 
   -----uca       -a       a gu      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 5771195-5771255 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR4409
gma-MIR5372chr16: 5771324-5771388 [-]
gma-MIR4409chr16: 5771195-5771255 [-]
Database links

Mature sequence gma-miR4409

Accession MIMAT0018328
Sequence

11 - 

uaacaaguggguuuguugacug

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).